Search Blogs

Showing results for "HashSet"

Found 16 results

LeetCode 3120: Count the Number of Special Characters I – Java HashSet Solution Explained

LeetCode 3120: Count the Number of Special Characters I – Java HashSet Solution Explained

IntroductionLeetCode 3120 – Count the Number of Special Characters I is a beginner-friendly string and hashing problem.This problem focuses on:Character manipulationUppercase and lowercase conversionHashSet usageString traversalBasic optimization techniquesIt is a good interview problem for testing:Understanding of ASCII charactersJava Character methodsSet operationsProblem-solving logicProblem Link🔗 https://leetcode.com/problems/count-the-number-of-special-characters-i/Problem StatementYou are given a string:wordA character is called:specialif it appears in both:LowercaseUppercaseReturn:Total number of special charactersExample 1Inputword = "aaAbcBC"Output3ExplanationCharacters:'a' and 'A''b' and 'B''c' and 'C'All appear in both cases.So answer is:3Example 2Inputword = "abc"Output:0No uppercase letters exist.Example 3Inputword = "abBCab"Output:1Only:'b' and 'B'appear in both forms.IntuitionWe need to check:For every lowercase character:Does its uppercase version exist?Using HashSet makes lookup very fast.Brute Force ApproachIdeaFor every character:Traverse entire stringSearch for uppercase/lowercase pairCount valid matchesBrute Force ComplexityTime ComplexityO(N²)because nested traversal is required.Space ComplexityO(1)Optimized HashSet ApproachIdeaUse two sets:One for lowercase lettersOne for uppercase lettersThen check matching pairs.Java Solutionclass Solution {public int numberOfSpecialChars(String word) {HashSet<Character> lower = new HashSet<>();HashSet<Character> upper = new HashSet<>();for(int i = 0; i < word.length(); i++) {if(word.charAt(i) >= 'a' && word.charAt(i) <= 'z') {lower.add(word.charAt(i));}else {upper.add(word.charAt(i));}}int ans = 0;for(int i = 0; i < word.length(); i++) {char up = Character.toUpperCase(word.charAt(i));if(lower.contains(word.charAt(i)) && upper.contains(up)) {ans++;lower.remove(word.charAt(i));upper.remove(up);}}return ans;}}Cleaner Optimized Versionclass Solution {public int numberOfSpecialChars(String word) {HashSet<Character> lower = new HashSet<>();HashSet<Character> upper = new HashSet<>();for(char ch : word.toCharArray()) {if(Character.isLowerCase(ch)) {lower.add(ch);}else {upper.add(ch);}}int count = 0;for(char ch : lower) {if(upper.contains(Character.toUpperCase(ch))) {count++;}}return count;}}Why This WorksWe separate:Lowercase charactersUppercase charactersThen for every lowercase letter:We check whether uppercase version exists.HashSet lookup works in:O(1)average time.Dry RunInputword = "aaAbcBC"Step 1Lowercase set:[a, b, c]Uppercase set:[A, B, C]Step 2Check:'a' → 'A' exists'b' → 'B' exists'c' → 'C' existsCount becomes:3Final Answer3Time Complexity AnalysisOptimized HashSet SolutionTime ComplexityO(N)because string traversal happens only once.Space ComplexityO(1)Maximum alphabet size is fixed:26 lowercase + 26 uppercaseBrute Force vs OptimizedApproachTime ComplexitySpace ComplexityBrute ForceO(N²)O(1)HashSet ApproachO(N)O(1)Interview ExplanationIn interviews, explain:We use two HashSets to separately store lowercase and uppercase letters. Then we check whether a lowercase character has its uppercase counterpart.This demonstrates:Efficient lookup usageHashing knowledgeCharacter manipulation skillsCommon Mistakes1. Double Counting CharactersWithout removing counted characters:same letter may be counted multiple times2. Forgetting Case ConversionAlways convert:Character.toUpperCase(ch)before comparison.3. Using Nested Loops UnnecessarilyHashSet reduces lookup complexity significantly.FAQsQ1. Why use HashSet?Because lookup operations are very fast.Q2. Can this be solved without extra space?Yes.Using arrays of size 26 is also possible.Q3. Why remove characters after counting?To avoid duplicate counting.Q4. Is this problem important for interviews?Yes.It tests:String handlingCharacter conversionHashSet usageOptimization thinkingRelated ProblemsPractice these next:Valid AnagramFirst Unique Character in a StringRansom NoteConclusionLeetCode 3120 is a simple but effective problem for learning:HashSet operationsString traversalCase conversionEfficient lookup techniquesThe key idea is:Store lowercase and uppercase letters separately, then check matching pairs efficiently.Once this pattern becomes clear, many string hashing problems become much easier.

LeetCodeJavaHashSetStringEasy
LeetCode 3483: Unique 3-Digit Even Numbers – Java Backtracking Solution

LeetCode 3483: Unique 3-Digit Even Numbers – Java Backtracking Solution

IntroductionWhat happens when a small collection of digits needs to be arranged into valid three-digit numbers?There are several conditions to satisfy at the same time:The number must contain exactly three digits.The first digit cannot be 0.The number must be even.A digit can only be used as many times as it appears in the input.Duplicate numbers should be counted only once.Because the input contains at most 10 digits, backtracking is a natural approach. Every possible arrangement can be generated, checked, and stored in a HashSet to ensure that only distinct numbers are counted.Question LinkLeetCode 3483 – Unique 3-Digit Even NumbersApproachThe idea is to build the number one digit at a time.A recursive function maintains:curr — the number currently being constructed.boo[] — tracks which positions of the input array have already been used.ms — a HashSet containing all valid three-digit numbers.At every recursion level, each unused digit is selected and appended to curr.Once three digits have been selected, three checks are performed:Leading zero012is not a valid three-digit number, so it is rejected.Even numberThe generated number must be divisible by 2.DistinctnessThe generated number is inserted into a HashSet, which automatically removes duplicates.Why Track Indices Instead of Digits?Consider:digits = [0, 2, 2]The digit 2 appears twice.Therefore, a valid number such as:220must be allowed.The boolean array tracks positions, not just digit values:Index: 0 1 2Digit: 0 2 2The two copies of 2 are therefore treated as two separate usable elements.The HashSet handles the other side of the problem: different index selections can produce the same number, but the final answer should count that number only once.Java Implementationclass Solution { // Stores every distinct valid three-digit number. HashSet<String> ms = new HashSet<>(); public void sol(int[] dig, String curr, boolean[] boo) { // Once three digits are selected, // check whether the generated number is valid. if (curr.length() == 3) { // A three-digit number cannot start with zero. if (curr.charAt(0) == '0') { return; } // Check whether the number is even. // HashSet automatically handles duplicates. if (ch(curr) && !ms.contains(curr)) { ms.add(curr); } return; } // Try every digit that has not been used yet. for (int i = 0; i < dig.length; i++) { // Skip the current digit if its array position // has already been used in this number. if (boo[i]) continue; String vl = String.valueOf(dig[i]); // Mark this position as used. boo[i] = true; // Add the digit to the current number // and continue building the number. sol(dig, curr + vl, boo); // Backtrack: make this position available // for another possible arrangement. boo[i] = false; } } // Checks whether the generated number is even. public boolean ch(String s) { int n = Integer.valueOf(s); return n % 2 == 0 ? true : false; } public int totalNumbers(int[] digits) { // Tracks which positions of the input array // are currently being used. boolean[] boo = new boolean[digits.length]; // Start generating numbers from an empty string. sol(digits, "", boo); // HashSet contains only distinct valid numbers. return ms.size(); }}Backtracking in ActionConsider:digits = [1, 2, 3, 4]The recursion starts with an empty string:""Choose 1:"1"Then choose 2:"12"Then choose 3:"123"The number has three digits, but 123 is odd, so it is rejected.Backtracking returns to:"12"and tries 4:"124"This number is three digits, does not start with zero, and is even.Therefore:124 → validThe recursion continues exploring other arrangements.Handling Duplicate DigitsConsider:digits = [0, 2, 2]The two 2s have different indices.Some recursion branches may therefore generate the same number:202from different copies of 2.Without a HashSet, these would be counted multiple times.With:HashSet<String> msonly one copy remains.The valid numbers are:202220Therefore:Answer = 2Dry RunConsider:digits = [1, 2, 3, 4]Some of the generated permutations include:123 → odd → reject124 → even → add132 → even → add134 → even → add142 → even → addThe recursion continues for all possible selections.Eventually, the set contains:124132134142214234312314324342412432So:ms.size() = 12The final answer is:12Why a HashSet Is UsefulThere are two separate concerns in this problem.Generating valid arrangementsBacktracking ensures that every possible selection of three positions is explored.Removing duplicatesThe HashSet ensures that identical numbers generated through different index choices are counted only once.This combination is especially useful when the input contains duplicate values.Complexity AnalysisLet n be the number of digits.At most 10 digits are given, and only three positions are selected.The number of possible index arrangements is:P(n, 3) = n × (n - 1) × (n - 2)Therefore, the number of generated arrangements is O(n³).For each completed arrangement, converting/checking the three-digit number takes constant time because the number always has exactly three digits.Time ComplexityO(n³)With n ≤ 10, this is very small in practice.Space ComplexityThe recursion depth is at most 3, while the HashSet stores the distinct valid numbers.So the auxiliary recursion space is O(1), excluding the result set.The result set contains at most a constant number of three-digit numbers because there are only 900 possible three-digit numbers.A Simpler ObservationThere is another way to think about the problem.A three-digit even number has the structure:Hundreds → Tens → UnitsThe units digit must be one of:0, 2, 4, 6, 8The hundreds digit cannot be zero.The tens digit can be any remaining available digit.This means the problem could also be solved by directly choosing:first digitsecond digitthird digitand checking whether the resulting number is valid.The backtracking solution generalizes this idea nicely because it systematically explores all possibilities.Interview TipWhen a problem asks to create numbers, strings, or arrangements from a small collection of elements, look for permutation/backtracking patterns.A useful checklist is:What is being built?↓How many elements are needed?↓Can an element be reused?↓How are duplicates handled?↓What makes a completed arrangement valid?For this problem:Build → 3-digit numberReuse → No, each copy onceDuplicates → HashSetValidity → No leading zero + evenThat immediately points toward a small backtracking solution.ConclusionLeetCode 3483 is a good introduction to combining backtracking with duplicate handling.The recursive function explores every possible three-digit arrangement while the boolean array ensures that each input position is used at most once. Once a number is completed, it is checked for the leading-zero and even-number conditions.Finally, a HashSet guarantees that duplicate numbers are counted only once.With at most 10 input digits and only three positions to fill, the brute-force search remains highly efficient and easy to understand.

LeetCodeJavaBacktrackingRecursionHashSetArraysPermutationsStringEasy
LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

LeetCode 187 – Repeated DNA Sequences (Java Solution with Sliding Window and HashSet)

IntroductionIn this article, we will solve LeetCode 187: Repeated DNA Sequences using Java. This is a popular string problem that tests your understanding of the sliding window technique and efficient use of hash-based data structures.DNA sequences are composed of four characters:A (Adenine)C (Cytosine)G (Guanine)T (Thymine)The goal is to identify all 10-letter-long substrings that appear more than once in a given DNA string.You can try solving the problem directly on LeetCode here: https://leetcode.com/problems/repeated-dna-sequences/Problem StatementGiven a string s that represents a DNA sequence, return all the 10-letter-long substrings that occur more than once.Example 1Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"Output: ["AAAAACCCCC", "CCCCCAAAAA"]Example 2Input: s = "AAAAAAAAAAAAA"Output: ["AAAAAAAAAA"]Key ObservationsWe only need substrings of fixed length 10.The maximum length of the string can be up to 10^5.A brute-force solution checking all substrings multiple times would be inefficient.This problem can be solved efficiently using a sliding window and hash-based data structures.Approach 1: Sliding Window with HashSet (Given Solution)IdeaUse two pointers (i and j) to maintain a sliding window.Build a substring of size 10 dynamically.Store previously seen substrings in a HashSet.If a substring is already present in the set:Check if it is already in the result list.If not, add it to the result list.Slide the window forward and continue.Java Code (Your Implementation)class Solution { public List<String> findRepeatedDnaSequences(String s) { HashSet<String> ms = new HashSet<>(); List<String> lis = new ArrayList<>(); int i = 0; int j = 0; String tes = ""; while (j < s.length()) { tes += s.charAt(j); if (j - i + 1 < 10) { j++; } else { if (j - i + 1 == 10) { if (ms.contains(tes)) { boolean fl = false; for (String a : lis) { if (a.equals(tes)) { fl = true; } } if (!fl) { lis.add(tes); } } else { ms.add(tes); } tes = tes.substring(1); i++; j++; } } } return lis; }}ExplanationThe variable tes maintains the current substring.ms stores all previously seen substrings of length 10.If a substring already exists in ms, we manually check whether it has already been added to the result list.This avoids duplicate entries in the final output.Time ComplexitySliding through the string: O(n)Checking duplicates in the result list: O(n) in the worst caseOverall worst-case complexity: O(n²)Space ComplexityHashSet storage: O(n)Limitation of Approach 1The manual duplicate check using a loop inside the result list introduces unnecessary overhead. This makes the solution less efficient.We can improve this by using another HashSet to automatically handle duplicates.Approach 2: Optimized Solution Using Two HashSetsIdeaUse one HashSet called seen to track all substrings of length 10.Use another HashSet called repeated to store substrings that appear more than once.Iterate from index 0 to s.length() - 10.Extract substring of length 10.If adding to seen fails, it means it has appeared before.Add it directly to repeated.This removes the need for a nested loop.Optimized Java Codeclass Solution { public List<String> findRepeatedDnaSequences(String s) { Set<String> seen = new HashSet<>(); Set<String> repeated = new HashSet<>(); for (int i = 0; i <= s.length() - 10; i++) { String substring = s.substring(i, i + 10); if (!seen.add(substring)) { repeated.add(substring); } } return new ArrayList<>(repeated); }}Why This Approach is BetterNo manual duplicate checking.Cleaner and more readable code.Uses HashSet properties efficiently.Each substring is processed only once.Time Complexity (Optimized)Single traversal of the string: O(n)Substring extraction of fixed length 10: O(1)Overall time complexity: O(n)Space ComplexityTwo HashSets storing substrings: O(n)ConclusionLeetCode 187 is a classic example of combining the sliding window technique with hash-based data structures.The first approach works but has unnecessary overhead due to manual duplicate checks.The second approach is more optimal, cleaner, and recommended for interviews.Always leverage the properties of HashSet to avoid redundant checks.This problem highlights the importance of choosing the right data structure to optimize performance.

JavaSliding WindowMedium
LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

LeetCode 36: Valid Sudoku Explained – Java Solutions, Intuition & Formula Dry Run

IntroductionSudoku is a universally beloved puzzle, but validating a Sudoku boardalgorithmically is a classic technical interview question. In this post, we aregoing to dive deep into LeetCode 36: Valid Sudoku.We won't just look at the code; we will explore the intuition behind the problemso you don't have to memorize anything. We’ll cover an ingenious in-placevalidation approach, break down the complex math formula used to check3 \times 3 sub-boxes, and look at an alternative optimal solution usingHashSets.Let's dive in!Understanding the ProblemThe problem asks us to determine if a partially filled 9 \times 9 Sudoku boardis valid. To be valid, the filled cells must follow three straightforward rules:1. Each row must contain the digits 1-9 without repetition.2. Each column must contain the digits 1-9 without repetition.3. Each of the nine 3 \times 3 sub-boxes must contain the digits 1-9 withoutrepetition.Important Note: A valid board doesn't mean the board is fully solvable! We onlycare about checking the numbers that are currently on the board.Intuition: How to Think About the ProblemBefore writing code, how do we, as humans, check if a Sudoku board is valid? Ifyou place a 5 in a cell, you quickly scan horizontally (its row), vertically(its column), and within its small 3 \times 3 square. If you see another 5, theboard is invalid.To translate this to code, we have two choices:1. The Simulation Approach: Go cell by cell. Pick up the number, hide it, andcheck its row, column, and 3 \times 3 box to see if that number existsanywhere else. (This is the approach we will look at first).2. The Memory Approach: Go cell by cell, but keep a "notebook" (like a HashTable) of everything we have seen so far. If we see a number we've alreadywritten down for a specific row, column, or box, it's invalid.Approach 1: The In-Place Validation (Space-Optimized)Here is a brilliant solution that validates the board without using any extradata structures.The Logic: Iterate through every cell on the board. When we find a number, wetemporarily replace it with a . (empty space). Then, we iterate 9 times to checkits entire row, column, and sub-box. If the number is found, we return false.Otherwise, we put the number back and move to the next cell.The Java Codeclass Solution {public boolean isvalid(char[][] board, int i, int j, char k) {for(int m = 0; m < 9; m++) {// Check rowif(board[i][m] == k) return false;// Check columnif(board[m][j] == k) return false;// Check 3x3 sub-boxif(board[3 * (i / 3) + m / 3][3 * (j / 3) + m % 3] == k) return false;}return true;}public boolean isValidSudoku(char[][] board) {for(int i = 0; i < board.length; i++) {for(int j = 0; j < board[0].length; j++) {if(board[i][j] != '.') {char temp = board[i][j];board[i][j] = '.'; // Temporarily remove the numberif(!isvalid(board, i, j, temp)) {return false;}board[i][j] = temp; // Put the number back}}}return true;}}The Math Breakdown: Demystifying the 3 \times 3 Grid FormulaThe hardest part of this code to understand is this exact line: board[3*(i/3) +m/3][3*(j/3) + m%3]How does a single loop variable m (from 0 to 8) traverse a 3 \times 3 grid?Let’s do a dry run.Step 1: Finding the Starting Point of the BoxThe grid is 9 \times 9, broken into nine 3 \times 3 boxes. If we are at a randomcell, say row i = 4, col j = 5, which box are we in? Because integer division inJava drops the decimal:i / 3 = 4 / 3 = 1j / 3 = 5 / 3 = 1Now multiply by 3 to get the actual starting coordinates (top-left corner) ofthat specific sub-box:3 * 1 = 3 (Row offset)3 * 1 = 3 (Col offset) So, the 3 \times 3 box starts at row 3, col 3.Step 2: Traversing the Box (Dry Run)Now, as m goes from 0 to 8, we use m / 3 for rows and m % 3 for columns:m = 0: row offset 0/3 = 0, col offset 0%3 = 0 \rightarrow Checks (3+0, 3+0) = (3, 3)m = 1: row offset 1/3 = 0, col offset 1%3 = 1 \rightarrow Checks (3+0, 3+1) = (3, 4)m = 2: row offset 2/3 = 0, col offset 2%3 = 2 \rightarrow Checks (3+0, 3+2) = (3, 5)m = 3: row offset 3/3 = 1, col offset 3%3 = 0 \rightarrow Checks (3+1, 3+0) = (4, 3)m = 4: row offset 4/3 = 1, col offset 4%3 = 1 \rightarrow Checks (3+1, 3+1) = (4, 4)...and so on up to m = 8.This brilliant math formula maps a 1D loop (0 to 8) directly onto a 2D3 \times 3 grid perfectly! No nested loops needed inside the isvalid function.Approach 2: The HashSet Solution (Single Pass)While the first approach is highly space-efficient, it does a bit of redundantchecking. An alternative approach that interviewers love is using a HashSet.Instead of checking rows and columns every time we see a number, we generate aunique "string signature" for every number and attempt to add it to a HashSet.If we see a 5 at row 0 and col 1, we create three strings:1. "5 in row 0"2. "5 in col 1"3. "5 in block 0-0"The HashSet.add() method returns false if the item already exists in the set. Ifit returns false, we instantly know the board is invalid!HashSet Java Code:class Solution {public boolean isValidSudoku(char[][] board) {HashSet<String> seen = new HashSet<>();for (int i = 0; i < 9; i++) {for (int j = 0; j < 9; j++) {char number = board[i][j];if (number != '.') {// HashSet.add() returns false if the element already existsif (!seen.add(number + " in row " + i) ||!seen.add(number + " in col " + j) ||!seen.add(number + " in block " + i/3 + "-" + j/3)) {return false;}}}}return true;}}Notice how we use i/3 + "-" + j/3 to identify the blocks. Top-left is block 0-0,bottom-right is block 2-2.Time and Space Complexity BreakdownInterviewers will always ask for your complexity analysis. Because a Sudokuboard is strictly fixed at 9 \times 9, the strict Big-O is actually constant.However, let's look at it conceptually as if the board were N \times N.Approach 1: In-Place Validation (Your Solution)Time Complexity: O(1) (Strictly speaking). We traverse 81 cells, and foreach cell, we do at most 9 iterations. 81 \times 9 = 729 operations. Since729 is a constant, it's O(1). (If the board was N \times N, time complexitywould be O(N^3) because for N^2 cells, we iterate N times).Space Complexity: O(1). We only use primitive variables (i, j, k, m, temp).No extra memory is allocated.Approach 2: HashSet ApproachTime Complexity: O(1). We traverse the 81 cells exactly once. Generatingstrings and adding to a HashSet takes O(1) time. (If the board wasN \times N, time complexity would be O(N^2)).Space Complexity: O(1). The HashSet will store a maximum of81 \times 3 = 243 strings. Since this upper limit is fixed, space isconstant.ConclusionThe Valid Sudoku problem is a fantastic exercise in matrix traversal andcoordinate math.When solving this in an interview:1. Use the first approach if you want to impress the interviewer with O(1)space complexity and your deep understanding of math formulas (the /3 and %3trick).2. Use the second approach (HashSet) if you want to show off your knowledge ofdata structures and write highly readable, clean, and clever code.I hope this breakdown gives you the intuition needed so you never have tomemorize the code for LeetCode 36!Happy Coding! Keep Learning🤟

LeetCodeJavaMatrixHash TableRecursionBacktrackingMedium
Contains Duplicate

Contains Duplicate

LeetCode Problem 217Link of the Problem to try -: LinkGiven an integer array nums, return true if any value appears at least twice in the array, and return false if every element is distinct.Example 1:Input: nums = [1,2,3,1]Output: trueExplanation:The element 1 occurs at the indices 0 and 3.Example 2:Input: nums = [1,2,3,4]Output: falseExplanation:All elements are distinct.Example 3:Input: nums = [1,1,1,3,3,4,3,2,4,2]Output: trueConstraints:1 <= nums.length <= 105-109 <= nums[i] <= 109Solution:1. The HashMap ApproachUsing a HashMap is a highly effective way to track occurrences. Although we are only checking for the existence of a value, the HashMap logic allows us to store the element as a "Key" and its frequency as a "Value."Logic:Iterate through the nums array.Before inserting an element, check if the HashMap already contains that key.If it exists, you've found your duplicate—return true.Otherwise, put the value into the map and continue.Code:public boolean containsDuplicate(int[] nums) {HashMap<Integer, Integer> map = new HashMap<>();for (int i = 0; i < nums.length; i++) {// Check if the current number is already a key in our mapif (map.containsKey(nums[i])) {return true;}// Map the number to its count (1)map.put(nums[i], 1);}return false;}2. The HashSet Approach (Optimized for Storage)While similar to the HashMap, the HashSet is often more appropriate for this specific problem because we only care if a number exists, not how many times it appears or what its index is.Logic:We initialize an empty HashSet.As we loop through the array, we check ms.contains(nums[i]).If the set already has the number, it's a duplicate.This approach is preferred over HashMap for this problem because it uses less memory and has cleaner syntax.Code:public boolean containsDuplicate(int[] nums) {HashSet<Integer> ms = new HashSet<>();for (int i = 0; i < nums.length; i++) {if (ms.contains(nums[i])) {return true;}ms.add(nums[i]);}return false;}3. The Sorting & Two-Pointer ApproachIf you want to avoid using extra memory (like a Set or Map), you can use the Two-Pointer method combined with Sorting.Logic:First, we sort the array. This ensures that any duplicate values are placed next to each other.We use two pointers: j (the previous element) and i (the current element).By moving these pointers across the array, we compare the values. If nums[i] == nums[j], a duplicate exists.Code:public boolean containsDuplicate(int[] nums) {// Step 1: Sort the arrayArrays.sort(nums);// Step 2: Use two pointers to compare adjacent elementsint j = 0;for (int i = 1; i < nums.length; i++) {if (nums[i] == nums[j]) {return true; // Duplicate found}j++; // Move the previous pointer forward}return false;}Performance SummaryApproachTime ComplexitySpace ComplexityRecommendationHashSetO(n)O(n)Best Overall – Fastest performance.HashMapO(n)O(n)Good, but HashSet is cleaner for this use case.Two PointerO(n \log n)O(1)Best for Memory – Use if space is limited.Final ThoughtsChoosing the right approach depends on whether you want to prioritize speed (HashSet) or memory efficiency (Two-Pointer). For most coding interviews, the HashSet solution is the "Gold Standard" due to its linear time complexity.

LeetCodeEasyHashMap
Intersection of Two Arrays

Intersection of Two Arrays

LeetCode Problem 349Link of the Problem to try -: LinkGiven two integer arrays nums1 and nums2, return an array of their intersection. Each element in the result must be unique and you may return the result in any order. Example 1:Input: nums1 = [1,2,2,1], nums2 = [2,2]Output: [2]Example 2:Input: nums1 = [4,9,5], nums2 = [9,4,9,8,4]Output: [9,4]Explanation: [4,9] is also accepted. Constraints:1 <= nums1.length, nums2.length <= 10000 <= nums1[i], nums2[i] <= 1000Solution: Using HashMap and HashSet for IntersectionCore Objective: The primary goal of this problem is to identify common elements between two arrays and return them as a unique set. To achieve this efficiently, we utilize a combination of a HashMap for quick lookup and a HashSet to handle uniqueness in the result.Logic & Implementation:Populate Lookup Table: We begin by iterating through the first array (nums1) and storing its elements in a HashMap. This allows us to verify the existence of any number in $O(1)$ average time.Identify Intersection: Next, we iterate through the second array (nums2). For each element, we check if it exists within our HashMap.Handle Uniqueness: If a match is found, we add the element to a HashSet. This is a crucial step because the problem requires the output to contain unique elements, even if a common number appears multiple times in the input arrays.Final Conversion: Since the required return type is an array, we determine the size of our HashSet to initialize the result array. Using a for-each loop, we transfer the values from the Set into the array and return it as the final answer.Code Implementation:public int[] intersection(int[] nums1, int[] nums2) { // HashMap to store elements from the first array for lookup HashMap<Integer, Integer> mp = new HashMap<>(); // HashSet to store unique common elements HashSet<Integer> ms = new HashSet<>(); // Populate the map with elements from nums1 for (int i = 0; i < nums1.length; i++) { if (mp.containsKey(nums1[i])) { continue; } mp.put(nums1[i], i); } // Check for common elements in nums2 for (int i = 0; i < nums2.length; i++) { if (mp.containsKey(nums2[i])) { ms.add(nums2[i]); // HashSet ensures duplicates are not added } } // Convert the HashSet to the final integer array int[] ans = new int[ms.size()]; int co = 0; for (int i : ms) { ans[co] = i; co++; } return ans;}

LeetCodeArrayEasyHashMap
LeetCode 41: First Missing Positive – O(n) Time and O(1) Space Java Solution

LeetCode 41: First Missing Positive – O(n) Time and O(1) Space Java Solution

IntroductionFinding the smallest positive integer missing from an unsorted array appears simple at first, but the problem becomes significantly more interesting because of its strict constraints.Problem Link -: First Missing PositiveGiven an unsorted integer array nums, the task is to return the smallest positive integer that does not appear in the array.For example:nums = [1,2,0]The positive integers begin with:1, 2, 3, 4, ...Both 1 and 2 are present, while 3 is missing.Therefore, the answer is:3The challenge is that the solution must run in:O(n) timeO(1) auxiliary spaceThis rules out several common approaches such as sorting and using a HashSet.Problem StatementGiven an unsorted integer array nums, return the smallest positive integer that is not present in the array.ExampleInput: nums = [3,4,-1,1]Output: 2The positive integers are:1, 2, 3, 4, ...1 exists in the array, but 2 does not.Therefore:Answer = 2Another example:Input: nums = [7,8,9,11,12]Output: 1Since 1 itself is missing, the answer is immediately:1Understanding the Important ObservationFor an array of length n, the answer can never be greater than:n + 1Consider:nums = [1,2,3]The first three positive integers are present:1, 2, 3Therefore, the smallest missing positive integer is:4Since n = 3:answer <= n + 1This observation is the key to the optimal solution.Numbers that are:<= 0or> ncannot directly determine the smallest missing positive number.The useful values are only:1 ... nThe Submitted HashSet ApproachA straightforward approach is to store every value in a HashSet and then search for the first missing positive integer.The basic idea is:Store all numbers ↓Check 1 ↓Check 2 ↓Check 3 ↓...The submitted implementation follows this idea:class Solution { public int firstMissingPositive(int[] nums) { int max = Integer.MIN_VALUE; HashSet<Integer> ms = new HashSet<>(); for (int a : nums) { max = Math.max(a, max); ms.add(a); } for (int i = 1; i <= max; i++) { if (!ms.contains(i)) { return i; } } if (max < 0) { return 1; } return max + 1; }}This approach is logically valid for finding the answer, but it does not satisfy the required constraints.Space ComplexityThe HashSet can store up to n elements.Therefore:O(n) auxiliary spaceThe problem requires:O(1) auxiliary spaceSo a different technique is required.Why Sorting Is Also Not EnoughSorting the array might appear to solve the problem easily.For example:[3,4,-1,1]After sorting:[-1,1,3,4]The missing positive integer can then be identified by scanning the array.However, sorting requires:O(n log n)time in the general case.The problem specifically requires:O(n)time.Therefore, sorting does not satisfy the required complexity either.The Core Idea: Put Every Number in Its Correct PositionThe optimal solution uses an in-place cyclic placement technique.The important relationship is:value 1 → index 0value 2 → index 1value 3 → index 2value 4 → index 3...In general:value x → index x - 1Consider:nums = [3,4,-1,1]The desired arrangement for useful values is:index: 0 1 2 3value: 1 2 3 4After placing the valid values into their corresponding positions, the array can become:[1, -1, 3, 4]Index 1 should contain:2but it contains -1.Therefore:answer = index + 1 = 1 + 1 = 2This transforms the problem from:Search for a missing number.into:Place every useful number at the position where it belongs, then find the first incorrect position.Which Numbers Should Be Placed?For an array of length n, only values satisfying:1 <= nums[i] <= nneed to be placed.Why?Suppose:n = 5The answer can only be one of:1,2,3,4,5,6A value such as:-4cannot be the answer.Similarly:10cannot prevent 1...6 from determining the answer.Therefore, values outside the range [1,n] can safely remain where they are.The Cyclic Placement ProcessFor every index i, check the current value:nums[i]If it belongs to the range:1 <= nums[i] <= nits correct index is:nums[i] - 1So the value should be swapped into:nums[nums[i] - 1]The process continues until the current position contains a value that either:is outside the useful range, oris already in its correct position.Why the Duplicate Check Is NecessaryConsider:nums = [1,1]The value 1 belongs at index 0.The first element is already correct.At index 1, the value is again 1.Trying to swap it repeatedly would cause an infinite loop because another 1 already occupies its correct position.Therefore, the swap condition must also ensure:nums[nums[i] - 1] != nums[i]This duplicate check is extremely important.Optimized Java Solutionclass Solution { public int firstMissingPositive(int[] nums) { int n = nums.length; for (int i = 0; i < n; i++) { while ( nums[i] >= 1 && nums[i] <= n && nums[nums[i] - 1] != nums[i] ) { int correctIndex = nums[i] - 1; int temp = nums[i]; nums[i] = nums[correctIndex]; nums[correctIndex] = temp; } } for (int i = 0; i < n; i++) { if (nums[i] != i + 1) { return i + 1; } } return n + 1; }}Dry RunConsider:nums = [3,4,-1,1]Array length:n = 4Initial Array[3, 4, -1, 1]At index 0:nums[0] = 3The correct index for 3 is:3 - 1 = 2Swap:[3, 4, -1, 1] ↓[-1, 4, 3, 1]The value at index 0 is now -1.Since -1 is outside [1,4], no further placement is required for this index.At index 1:nums[1] = 4Correct index:4 - 1 = 3Swap:[-1, 4, 3, 1] ↓[-1, 1, 3, 4]Now:nums[1] = 1The correct index of 1 is 0.Swap:[-1, 1, 3, 4] ↓[1, -1, 3, 4]Now index 1 contains -1, so placement stops.Final Arrangement[1, -1, 3, 4]The expected value at each index is:index 0 → 1 ✓index 1 → 2 ✗index 2 → 3 ✓index 3 → 4 ✓The first incorrect position is:index = 1Therefore:answer = index + 1 = 2Another ExampleConsider:nums = [1,2,0]The values 1 and 2 are already in their correct positions:[1,2,0]Expected arrangement:index 0 → 1 ✓index 1 → 2 ✓index 2 → 3 ✗The first incorrect position is index 2.Therefore:answer = 2 + 1 = 3Edge Case: All Positive Numbers Are PresentConsider:nums = [1,2,3]Every position contains the expected value:index 0 → 1index 1 → 2index 2 → 3No missing value exists between 1 and n.Therefore, the smallest missing positive integer is:n + 1So:answer = 4Edge Case: The Answer Is 1Consider:nums = [7,8,9,11,12]All values are greater than 1.After the placement phase, there is no 1 at index 0.Therefore:answer = 1Complexity AnalysisThe algorithm uses the array itself to store values in their correct positions.Time ComplexityAlthough the algorithm contains a nested while loop, the total number of swaps is bounded by O(n) because every successful swap places a useful value into its correct position.Therefore:Time Complexity: O(n)Space ComplexityNo additional data structure proportional to the input size is used.Only a few variables are required:Space Complexity: O(1)This satisfies the required constraints.Why the Algorithm WorksThe central invariant is:Whenever a value x lies in the range [1,n], the algorithm attempts to place it at index x-1.After the placement phase, every value that can occupy a meaningful position is either:at its correct indexorabsent from the arrayTherefore, scanning from left to right provides a direct answer.If:nums[i] != i + 1then i + 1 is missing.If every position is correct, then all values from:1 ... nexist, making:n + 1the smallest missing positive integer.Interview InsightThis problem is an important example of in-place array positioning.The key pattern is:Value x ↓Correct index = x - 1Whenever an array problem asks for a missing, duplicate, or misplaced number within a known range, it is worth checking whether the values themselves can be mapped directly to indices.This technique appears in several interview problems involving:Missing numbersDuplicate numbersCyclic sortIn-place rearrangementFrequency representation without extra memoryThe biggest clue in this problem is the combination of:Unsorted array+O(n) time+O(1) space+Positive integersThat combination strongly suggests an in-place index/value mapping strategy.ConclusionLeetCode 41, First Missing Positive, is a classic example of turning the array itself into auxiliary storage.A HashSet provides an easy solution but requires O(n) extra space. Sorting simplifies the search but requires O(n log n) time. The optimal solution instead uses the relationship:value x → index x - 1to rearrange useful values directly inside the input array.After this placement, the first index whose value does not match index + 1 identifies the smallest missing positive integer.The final complexity is:O(n) timeO(1) auxiliary spacemaking the approach suitable for the strict constraints and an important pattern to recognize in technical interviews.

LeetCodeJavaArraysCyclic SortHardHashSet
LeetCode 1306: Jump Game III – Java DFS & Graph Traversal Solution Explained

LeetCode 1306: Jump Game III – Java DFS & Graph Traversal Solution Explained

IntroductionLeetCode 1306 – Jump Game III is an interesting graph traversal problem that combines:Depth First Search (DFS)Breadth First Search (BFS)RecursionVisited trackingCycle detectionAt first glance, this problem looks like an array problem.But internally, it behaves exactly like a graph traversal problem where:Each index acts like a nodeEach jump acts like an edgeThis problem is commonly asked in coding interviews because it tests:Recursive thinkingGraph traversal intuitionAvoiding infinite loopsState trackingProblem Link🔗 https://leetcode.com/problems/jump-game-iii/Problem StatementYou are given:An array arrA starting index startFrom index i, you can jump:i + arr[i]ori - arr[i]Your goal is to determine whether you can reach any index having value:0ExampleInputarr = [4,2,3,0,3,1,2]start = 5OutputtrueExplanationPossible path:5 → 4 → 1 → 3At index:3Value becomes:0So answer is:trueUnderstanding the ProblemThink of every index as a graph node.From each node:index iwe have two possible edges:i + arr[i]andi - arr[i]The goal is simply:Can we reach any node containing value 0?Brute Force IntuitionA naive recursive solution would:Try both forward and backward jumpsContinue recursivelyStop when we find zeroWhy Brute Force FailsWithout tracking visited indices, recursion may enter infinite loops.Example:1 → 3 → 1 → 3 → 1...This creates cycles.So we must track visited nodes.DFS IntuitionWe perform DFS traversal from the starting index.At every index:Check boundariesCheck if already visitedCheck if value is zeroExplore both possible jumpsKey DFS ObservationEach index should only be visited once.Why?Because revisiting creates cycles and unnecessary computation.So we use:HashSet<Integer> visitedorboolean[] visitedRecursive DFS ApproachSteps1. Boundary CheckIf index goes outside array:return false2. Visited CheckIf already visited:return false3. Found ZeroIf current index contains:0Return:true4. Explore Both DirectionsTry:start + arr[start]andstart - arr[start]Java DFS Solutionclass Solution { public boolean solve(HashSet<Integer> zeroIndexes, HashSet<Integer> visited, int start, int[] arr) { if(start >= arr.length || start < 0) return false; if(visited.contains(start)) return false; visited.add(start); if(zeroIndexes.contains(start)) return true; return solve(zeroIndexes, visited, start + arr[start], arr) || solve(zeroIndexes, visited, start - arr[start], arr); } public boolean canReach(int[] arr, int start) { HashSet<Integer> visited = new HashSet<>(); HashSet<Integer> zeroIndexes = new HashSet<>(); for(int i = 0; i < arr.length; i++) { if(arr[i] == 0) { zeroIndexes.add(i); } } return solve(zeroIndexes, visited, start, arr); }}Simpler Optimized DFS SolutionWe actually do not need a separate set for zero indexes.We can directly check:arr[start] == 0Cleaner Java DFS Solutionclass Solution { public boolean dfs(int[] arr, boolean[] visited, int start) { if(start < 0 || start >= arr.length) return false; if(visited[start]) return false; if(arr[start] == 0) return true; visited[start] = true; return dfs(arr, visited, start + arr[start]) || dfs(arr, visited, start - arr[start]); } public boolean canReach(int[] arr, int start) { return dfs(arr, new boolean[arr.length], start); }}Dry RunInputarr = [4,2,3,0,3,1,2]start = 5Step 1Current index:5Value:1Possible jumps:5 + 1 = 65 - 1 = 4Step 2Visit index:4Value:3Possible jumps:4 + 3 = 7 (invalid)4 - 3 = 1Step 3Visit index:1Value:2Possible jumps:1 + 2 = 31 - 2 = -1 (invalid)Step 4Visit index:3Value:0Return:trueBFS ApproachThis problem can also be solved using BFS.Instead of recursion:Use queueExplore neighbors level by levelJava BFS Solutionclass Solution { public boolean canReach(int[] arr, int start) { Queue<Integer> queue = new LinkedList<>(); boolean[] visited = new boolean[arr.length]; queue.offer(start); while(!queue.isEmpty()) { int index = queue.poll(); if(index < 0 || index >= arr.length) continue; if(visited[index]) continue; if(arr[index] == 0) return true; visited[index] = true; queue.offer(index + arr[index]); queue.offer(index - arr[index]); } return false; }}Time Complexity AnalysisDFS ComplexityTime ComplexityO(N)Each index is visited at most once.Space ComplexityO(N)Due to recursion stack and visited array.BFS ComplexityTime ComplexityO(N)Space ComplexityO(N)DFS vs BFSApproachAdvantagesDisadvantagesDFSSimple recursive logicRecursion stackBFSIterative solutionQueue managementInterview ExplanationIn interviews, explain:This problem behaves like graph traversal where each index acts as a node and jumps act as edges. We use DFS or BFS with visited tracking to avoid infinite cycles.This demonstrates strong graph intuition.Common Mistakes1. Forgetting Visited TrackingThis causes infinite recursion.2. Missing Boundary ChecksAlways check:start < 0 || start >= arr.length3. Revisiting NodesAvoid processing already visited indices.FAQsQ1. Is this an array problem or graph problem?Internally it is a graph traversal problem.Q2. Which is better: DFS or BFS?Both are valid.DFS is usually simpler for this problem.Q3. Why do we need visited tracking?To avoid infinite loops caused by cycles.Q4. Can this be solved greedily?No.Because multiple paths must be explored.ConclusionLeetCode 1306 is an excellent beginner-friendly graph traversal problem.It teaches:DFS traversalBFS traversalCycle detectionRecursive thinkingVisited state managementThe most important insight is:Treat every index as a graph node.Once you understand this idea, many graph and traversal interview problems become much easier.

LeetCodeMediumDFSBFSGraph TraversalJavaRecursion
LeetCode 2196: Create Binary Tree From Descriptions – Java HashMap & Tree Construction Solution

LeetCode 2196: Create Binary Tree From Descriptions – Java HashMap & Tree Construction Solution

IntroductionBinary tree construction problems are extremely common in coding interviews because they test multiple concepts together:Tree data structuresHashMap usageParent-child relationshipsGraph-style thinkingRoot identificationLeetCode 2196 is an excellent medium-level problem that focuses on constructing a binary tree from parent-child descriptions efficiently.In this article, we will deeply understand:How the tree is formedHow to identify the root nodeWhy HashMap is useful hereStep-by-step dry runTime and space complexityComplete optimized Java solutionProblem StatementYou are given a 2D array:descriptions[i] = [parent, child, isLeft]Where:parent is the parent nodechild is the child nodeisLeft == 1 means left childisLeft == 0 means right childYour task is to:Construct the binary treeReturn the root nodeHere is the Link to try it now -: Create Binary Tree From DescriptionsExampleInputdescriptions = [ [20,15,1], [20,17,0], [50,20,1], [50,80,0], [80,19,1]]Output[50,20,80,15,17,19]Visual Representation 50 / \ 20 80 / \ / 15 17 19Key ObservationEvery node except the root appears as a child exactly once.This means:Root node never appears in child positionsIf we store all child nodes,The node not present in the child set becomes the rootThis is the core trick of the problem.Approach OverviewWe solve the problem in 3 steps:Step 1: Find the Root NodeStore every child node in a HashSet.Then iterate through descriptions again:The parent that never appears as a child is the root.Step 2: Create Tree NodesUse a HashMap:value → TreeNodeThis prevents duplicate node creation.Step 3: Connect Parent and ChildBased on:isLeftattach nodes accordingly.Optimized Java Solutionclass Solution { public TreeNode createBinaryTree(int[][] descriptions) { HashSet<Integer> childSet = new HashSet<>(); // Store all child nodes for (int[] arr : descriptions) { childSet.add(arr[1]); } // Find root node int rootValue = -1; for (int[] arr : descriptions) { if (!childSet.contains(arr[0])) { rootValue = arr[0]; } } // Map value -> TreeNode HashMap<Integer, TreeNode> map = new HashMap<>(); for (int i = 0; i < descriptions.length; i++) { int parent = descriptions[i][0]; int child = descriptions[i][1]; int isLeft = descriptions[i][2]; // Create parent node if absent if (!map.containsKey(parent)) { map.put(parent, new TreeNode(parent)); } // Create child node if absent if (!map.containsKey(child)) { map.put(child, new TreeNode(child)); } // Connect nodes if (isLeft == 1) { map.get(parent).left = map.get(child); } else { map.get(parent).right = map.get(child); } } return map.get(rootValue); }}Step-by-Step ExplanationStep 1: Store All Child NodeschildSet.add(arr[1]);Every child is stored.Since root never becomes a child,it will not exist inside this set.Step 2: Identify Rootif (!childSet.contains(arr[0]))This finds the node that only acts as parent.That node becomes the root.Step 3: Create Unique Tree NodesHashMap<Integer, TreeNode> mapAvoids duplicate node creation.Each value maps to exactly one TreeNode.Step 4: Connect Parent and Childmap.get(parent).left = map.get(child);ormap.get(parent).right = map.get(child);depending on:isLeftDry RunInput[ [20,15,1], [20,17,0], [50,20,1], [50,80,0], [80,19,1]]Child Set15, 17, 20, 80, 19Root DetectionCheck parents:20 → exists in child set50 → NOT in child setSo:Root = 50Tree Construction50left → 20right → 8020left → 15right → 1780left → 19Final tree becomes: 50 / \ 20 80 / \ / 15 17 19Time ComplexityBuilding Child SetO(N)Finding RootO(N)Constructing TreeO(N)Total Time ComplexityO(N)Efficient for large constraints.Space ComplexityHashMap + HashSetO(N)Why This Problem is ImportantThis problem teaches:Tree constructionParent-child mappingRoot identificationEfficient object reuseHashMap optimizationIt is frequently asked in interviews because it combines multiple concepts in one clean implementation.Common Mistakes1. Creating Duplicate NodesWrong:new TreeNode(parent)every time.Always reuse nodes through HashMap.2. Incorrect Root DetectionRemember:Root never appears as child.3. Forgetting Left vs Right ChildAlways check:isLeftbefore attaching.Interview TipsIn interviews explain:We first identify the root using a child set, then use a HashMap to create and reuse TreeNode objects efficiently while connecting parent-child relationships.This demonstrates:Strong data structure understandingEfficient memory usageClean tree construction logicRelated ProblemsPractice these next:Construct Binary Tree from TraversalsValidate Binary Search TreeSerialize and Deserialize Binary TreeLowest Common AncestorBinary Tree Level Order TraversalConclusionLeetCode 2196 is a clean and elegant binary tree construction problem.The major insight is:The root node is the only node that never appears as a child.Combined with HashMap-based node reuse, we can construct the entire tree efficiently in linear time.This is an excellent interview problem for mastering tree construction patterns.

LeetCodeJavaTreeHashMapHashSetBinary TreeMedium
Count the Number of Good Subarrays – Apple OA DSA Problem & Java Solution

Count the Number of Good Subarrays – Apple OA DSA Problem & Java Solution

IntroductionThis is an interesting question asked in the Apple OA because the condition is slightly different from the usual subarray problems.Instead of asking whether a subarray itself satisfies some property, the task is to remove a subarray and check whether the elements left behind are strictly increasing.The challenge is to count every possible contiguous subarray whose removal leaves a strictly increasing sequence.With n as large as 10⁵, a direct brute-force solution becomes extremely expensive, making this a good problem for thinking about how the structure of the array can be exploited.Problem StatementGiven an integer array arr of size n, find the number of good subarrays.A subarray arr[l...r] is called good if, after removing all elements from index l through r, the remaining elements form a strictly increasing array.In other words, after removing:arr[l], arr[l+1], ..., arr[r]the elements before l and after r are joined together.The resulting array must satisfy:remaining[i] < remaining[i + 1]for every pair of adjacent elements.Constraints1 ≤ n ≤ 10⁵-10⁹ ≤ arr[i] ≤ 10⁹ExampleConsider:arr = [1, 2, 3, 4, 0, 5]There are 10 good subarrays.Some valid removals are:[0][0, 5][4, 0][4, 0, 5][3, 4, 0][3, 4, 0, 5][2, 3, 4, 0][2, 3, 4, 0, 5][1, 2, 3, 4, 0][1, 2, 3, 4]For example, removing:[3, 4, 0]from:[1, 2, 3, 4, 0, 5]leaves:[1, 2, 5]which is strictly increasing.Therefore, [3,4,0] is a good subarray.Similarly, removing:[0,5]leaves:[1,2,3,4]which is also strictly increasing.Hence:Answer = 10Key ObservationThe array:[1, 2, 3, 4, 0, 5]is already strictly increasing except around:4 → 0Removing a suitable contiguous section containing this problematic portion can reconnect two increasing parts.For example:[1, 2, 3, 4] [0, 5]Removing [0] gives:[1, 2, 3, 4, 5]Removing [4,0] gives:[1, 2, 3, 5]Removing [3,4,0] gives:[1, 2, 5]The important condition is therefore not just whether the removed part is valid. The remaining left and right portions must also connect correctly.Brute-Force Backtracking ApproachA straightforward way to explore the problem is to generate possible selections of indices using recursion.The recursive function maintains:currwhich contains the indices currently selected for removal.For every index, there are two choices:Include the index in the selected set.Do not include the index.Once a selection is created, the ch2() function removes those selected positions and checks whether the remaining array is strictly increasing.A HashSet is also used to avoid counting the same index selection more than once.Checking a CandidateThe ch2() function performs the validation.It first creates an array containing the elements that were not selected for removal.For example:Original:[1, 2, 3, 4, 0, 5]Selected indices:[2, 3, 4]Remaining:[1, 2, 5]Then the remaining array is scanned.If any adjacent pair violates:arr[i] < arr[i + 1]the candidate is rejected.Otherwise, it is considered good.Java SolutionThe following is the provided recursive implementation, with comments added to make the logic easier to follow.public class question {// Stores already counted selections.static int an = 0;static HashSet<List<Integer>> msl = new HashSet<>();// Checks whether removing the selected indices// leaves a strictly increasing array.public static boolean ch2(List<Integer> lis, int[] arr) {// No selected elements means nothing is removed.if (lis.size() == 0) {return false;}// If the entire array is removed,// this implementation does not count it.int[] dum = new int[arr.length - lis.size()];if (dum.length == 0) {return false;}// Store the selected indices.HashSet<Integer> ms = new HashSet<>();for (int a : lis) {ms.add(a);}int c = 0;// Construct the remaining array.for (int i = 0; i < arr.length; i++) {// Keep only indices that were not selected.if (!ms.contains(i)) {dum[c] = arr[i];c++;}}// Check whether the remaining array// is strictly increasing.for (int i = 0; i < dum.length - 1; i++) {if (dum[i] > dum[i + 1]) {return false;}}return true;}public static void main(String[] args) {int[] arr = {1, 2, 3, 4, 0, 5};List<Integer> lis = new ArrayList<>();if (arr.length == 1) {System.out.println(1);}// Explore both possibilities for the first index.sol2(arr, 0, lis, true);sol2(arr, 0, lis, false);System.out.println(an);}// Generates different selections using recursion.public static void sol2(int[] arr,int ind,List<Integer> lis,boolean boo) {// All indices have been processed.if (ind == arr.length) {// Check whether this selection is good// and has not already been counted.if (!msl.contains(lis) && ch2(lis, arr)) {an++;// Store a copy because the original list// continues changing during backtracking.msl.add(new ArrayList<>(lis));System.out.println(lis);}return;}// Check the current selection as well.if (!msl.contains(lis) && ch2(lis, arr)) {an++;msl.add(new ArrayList<>(lis));System.out.println(lis);}// Include the current index.if (boo) {lis.add(ind);}// Continue recursively.sol2(arr, ind + 1, lis, true);// Backtrack and remove the last selected index.if (lis.size() != 0) {lis.remove(lis.size() - 1);}// Explore the branch where the current index// is not selected.sol2(arr, ind + 1, lis, false);}}Dry RunFor:[1, 2, 3, 4, 0, 5]Suppose the selected indices are:[4]Index 4 contains 0.Removing it gives:[1, 2, 3, 4, 5]This is strictly increasing.Therefore:[0]is counted.Now consider:[3, 4]Removing indices 2 and 3 gives:[1, 2, 0, 5]Since:2 > 0the remaining array is not increasing.Therefore, this candidate is rejected.Another candidate:[2, 3, 4]removes:[3, 4, 0]and leaves:[1, 2, 5]which is strictly increasing.So this candidate is counted.The recursion continues until all possible selections have been explored.Important Detail: Subarray vs SubsetThere is an important distinction worth understanding when reviewing this implementation.The problem asks for a subarray, which means the removed elements must be contiguous.For example:[2, 3, 4]is a subarray.But:[2, 4]is not a subarray if the original array contains another element between them.The recursive code, however, chooses individual indices independently. Therefore, it explores subsets of indices rather than explicitly restricting the selection to contiguous ranges.This is an important conceptual difference.For a production or interview solution, the recursion should be changed to work directly with:left indexright indexso that only contiguous removals are considered.Why This Approach Is Not Suitable for n = 10⁵For every index, the recursion can make two choices:includeexcludeThis creates approximately:2ⁿpossible selections.Furthermore, each candidate is checked by constructing another array and scanning it.Therefore, the brute-force approach grows exponentially and cannot handle:n = 100000efficiently.This makes the problem much more interesting: the real challenge is finding the structure that allows the count to be obtained without examining every possible subarray individually.Toward an Optimized SolutionA useful way to analyze the problem is to split the remaining array into two parts.After removing arr[l...r], the remaining array is:arr[0...l-1] + arr[r+1...n-1]For this combined array to be strictly increasing, three things must be true:Left part must be increasingarr[0...l-1]must already be strictly increasing.Right part must be increasingarr[r+1...n-1]must already be strictly increasing.The two parts must connectIf both parts exist:arr[l-1] < arr[r+1]must hold.This observation removes the need to construct the remaining array for every candidate.The Main PatternThe problem can therefore be viewed as:Increasing Prefix|| removed subarray↓Increasing SuffixThe only difficult part is determining whether the last element of the prefix can connect to the first element of the suffix.This is the key observation that leads from brute force toward an efficient two-pointer/prefix-suffix based solution.Complexity of the Provided SolutionThe recursive generation can explore up to:O(2ⁿ)different index selections.For every candidate, ch2() may also scan the entire array.Therefore, the overall worst-case complexity is approximately:O(n × 2ⁿ)with substantial additional memory for the recursion and stored selections.This is only practical for very small arrays and should be considered a brute-force exploration, not a solution for the stated n = 10⁵ constraint.Interview TakeawayThis problem teaches an important DSA lesson:Before optimizing code, identify exactly what the problem is asking for.There is a significant difference between:subsetand:subarrayA subset can select arbitrary indices, while a subarray must be contiguous.Once the problem is represented correctly, the next question becomes:What must be true about the array remaining after removing [l...r]?That leads directly to the prefix/suffix observation:Left side increasing+Right side increasing+Left boundary < Right boundaryThis type of transformation is often much more valuable in an OA than trying to optimize an exponential recursion line by line.ConclusionThis Apple OA-style problem combines subarray reasoning, recursion, and array properties in an interesting way.The provided solution takes a brute-force route by recursively exploring possible index selections and checking whether the remaining elements form a strictly increasing sequence.Although this approach is useful for understanding the problem and verifying small test cases, the constraint of 10⁵ requires a much more efficient strategy.The major insight is to stop thinking about the removed portion itself and instead analyze the increasing prefix and increasing suffix that remain after the removal.That shift in perspective turns an exponential search problem into one that can be approached using prefix/suffix preprocessing and two-pointer techniques.

Apple OAArraysSubarraysRecursionBacktrackingHashSetBrute ForceJavaContignous Array
LeetCode 2657: Find the Prefix Common Array of Two Arrays – Java Hashing Solution Explained

LeetCode 2657: Find the Prefix Common Array of Two Arrays – Java Hashing Solution Explained

IntroductionLeetCode 2657 – Find the Prefix Common Array of Two Arrays is an interesting prefix and hashing problem that tests your understanding of:Prefix processingHashingFrequency countingSet operationsArray traversalAt first glance, the problem may look confusing because of the term:Prefix Common ArrayBut once you understand the meaning of prefixes and common elements, the problem becomes straightforward.This problem is useful for improving:Prefix-based thinkingHashing intuitionOptimization skillsInterview problem-solving abilityProblem Link🔗 Find the prefix Common Array of Two ArraysProblem StatementYou are given two permutations:A and BBoth arrays contain numbers:1 to nexactly once.You need to create an array:Cwhere:C[i]represents:Count of numbers present in both arrays from index 0 to i.Understanding Prefix Common ArraySuppose:A = [1,3,2,4]B = [3,1,2,4]Prefix at Index 0A Prefix = [1]B Prefix = [3]Common numbers:NoneSo:C[0] = 0Prefix at Index 1A Prefix = [1,3]B Prefix = [3,1]Common numbers:1, 3So:C[1] = 2Final Output[0,2,3,4]Key ObservationBoth arrays are permutations.This means:Every number appears exactly once.Once a number appears in both prefixes, it remains common forever.This simplifies the logic significantly.Brute Force ApproachIntuitionFor every index:Build prefixesCompare elementsCount common numbersBrute Force AlgorithmFor each index:Traverse all previous elementsCheck whether numbers exist in both prefixesCount matchesBrute Force ComplexityTime ComplexityO(N²)because for every index we may scan previous elements.Space ComplexityO(N)Understanding ApproachThis approach uses:HashMapPrefix trackingCounting common valuesThe idea is:Store prefix elements from BTraverse A prefixCount matching numbersThis works because prefixes gradually expand.Java Solutionclass Solution { public int[] findThePrefixCommonArray(int[] A, int[] B) { int j = 0; int[] ans = new int[A.length]; HashMap<Integer, Integer> map = new HashMap<>(); for(int i = 0; i < A.length; i++) { map.put(B[i], i); int counter = 0; int c = 0; for(int a : map.keySet()) { if(map.containsKey(A[c])) { counter++; } c++; } ans[j] = counter; j++; } return ans; }}Better Optimized ApproachWe can solve this more cleanly using:HashSetor frequency counting.Optimized IntuitionAt every index:Add A[i]Add B[i]Track which numbers appearedIf a number appears in both arrays, increase common countBest Optimized Approach Using Frequency ArrayBecause values are from:1 to nwe can use a frequency array.Optimized Java Solutionclass Solution { public int[] findThePrefixCommonArray(int[] A, int[] B) { int n = A.length; int[] ans = new int[n]; int[] freq = new int[n + 1]; int common = 0; for(int i = 0; i < n; i++) { freq[A[i]]++; if(freq[A[i]] == 2) common++; freq[B[i]]++; if(freq[B[i]] == 2) common++; ans[i] = common; } return ans; }}Why Does This Work?Every number appears once in A and once in B.So:First appearance → frequency becomes 1Second appearance → frequency becomes 2When frequency becomes:2it means the number has appeared in both prefixes.So we increase:commonDry RunInputA = [1,3,2,4]B = [3,1,2,4]Step 1Index:0Add:1 and 3Frequencies:1 → 13 → 1No common elements.ans[0] = 0Step 2Add:3 and 1Frequencies:1 → 23 → 2Two common elements found.ans[1] = 2Step 3Add:2 and 2Frequency:2 → 2Common becomes:3ans[2] = 3Step 4Add:4 and 4Frequency:4 → 2Common becomes:4ans[3] = 4Final Output[0,2,3,4]Time Complexity AnalysisTime ComplexityO(N²)Nested traversal inside loop.Space ComplexityO(N)Optimized Frequency ApproachTime ComplexityO(N)Single traversal.Space ComplexityO(N)Frequency array.HashMap vs Frequency ArrayApproachTime ComplexitySpace ComplexityHashMapO(N²)O(N)Frequency ArrayO(N)O(N)Interview ExplanationIn interviews, explain:Since both arrays are permutations, every number appears exactly twice overall — once in A and once in B. Using frequency counting, whenever a number’s frequency becomes 2, it means it has appeared in both prefixes.This demonstrates:Prefix understandingOptimization thinkingHashing skillsCommon Mistakes1. Recalculating Common Elements Every TimeThis causes:O(N²)complexity.2. Forgetting Arrays Are PermutationsThis special condition allows frequency optimization.3. Incorrect Prefix LogicRemember:Prefix means elements from 0 to i.FAQsQ1. Why is this called Prefix Common Array?Because:C[i]stores common elements between prefixes ending at index:iQ2. Why does frequency 2 mean common?Because every number appears once in each array.Q3. Which approach is best?Frequency array approach is the most optimized.Q4. Is this problem important for interviews?Yes.It tests:Prefix logicHashingOptimizationArray traversalRelated ProblemsAfter mastering this problem, practice:Intersection of Two ArraysIntersection of Two Arrays IIContains DuplicateSubarray Sum Equals KPrefix SumFind the Difference of Two ArraysConclusionLeetCode 2657 is an excellent prefix and hashing problem.It teaches:Prefix processingFrequency countingOptimization techniquesHashing fundamentalsThe key insight is:A number becomes common exactly when its frequency becomes 2.Once you understand this observation, the optimized solution becomes very simple and efficient.

LeetCodePrefix Common ArrayJavaHashMapHashSetArrayPrefixArrayMedium
Unique Number of Occurrences

Unique Number of Occurrences

LeetCode Problem 1207Link of the Problem to try -: LinkGiven an array of integers arr, return true if the number of occurrences of each value in the array is unique or false otherwise.Example 1:Input: arr = [1,2,2,1,1,3]Output: trueExplanation: The value 1 has 3 occurrences, 2 has 2 and 3 has 1. No two values have the same number of occurrences.Example 2:Input: arr = [1,2]Output: falseExample 3:Input: arr = [-3,0,1,-3,1,1,1,-3,10,0]Output: trueConstraints:1 <= arr.length <= 1000-1000 <= arr[i] <= 1000Solution:It is a little bit tricky question as it says you have to return true if the elements frequency contained by the array is distinct and no frequency is same if it is then return true otherwise false. So for solving this we can use HashMap to make frequency of each element then we will create a Set and store all the values of HashMap elements in the Set and then we will simply compare sizes of both Map and Set as we know that if each element frequency is unique then the sizes are same otherwise size are not same and that is a key point to solve this question very easily.Code:HashMap<Integer,Integer> mp = new HashMap<>();Set<Integer> ms = new HashSet<>();for(int i=0;i<arr.length;i++){mp.put(arr[i],mp.getOrDefault(arr[i],0)+1);}for(int u:mp.values()){ms.add(u);}if(ms.size() == mp.size()){return true;}else{return false;}

LeetCodeHashMapHashSet
LeetCode 845: Longest Mountain in Array – Java Solution with Peak Expansion

LeetCode 845: Longest Mountain in Array – Java Solution with Peak Expansion

IntroductionA mountain subarray is a contiguous portion of an array that first strictly increases and then strictly decreases.For example:[1, 4, 7, 3, 2] ↑ PeakThe array increases toward 7 and decreases after 7, making it a valid mountain of length 5.The goal is to find the longest mountain subarray in the given array.This problem is useful for understanding an important array pattern:Find a valid peak → expand around the peak → calculate the complete structure.The follow-up also asks for a solution using one pass and O(1) extra space, making it a good interview problem for learning how to optimize array traversal.Problem StatementProblem Link -: longest mountain subarrayGiven an integer array arr, return the length of the longest contiguous subarray that forms a mountain.A valid mountain must:Contain at least 3 elements.Strictly increase toward a peak.Strictly decrease after the peak.Have the peak somewhere between the first and last element.For example:[2, 1, 4, 7, 3, 2, 5]The longest mountain is:[1, 4, 7, 3, 2] ↑ peakTherefore:Answer = 5Understanding the PatternThe most important observation is that every valid mountain has a peak.A peak is an element satisfying:arr[i - 1] < arr[i] > arr[i + 1]For example:1 4 7 3 2 ↑ iAt index 2:4 < 77 > 3Therefore, 7 is a peak.Once a peak is found, the complete mountain can be discovered by expanding: peak ↓1 → 4 → 7 ← 3 ← 2 ←──── ────→The left side continues while values are increasing toward the peak.The right side continues while values are decreasing away from the peak.Approach: Expand Around Every PeakThe solution can be divided into three simple steps.Find every possible peakTraverse the array from index 1 to n - 2.For every index:arr[i - 1] < arr[i] && arr[i] > arr[i + 1]If this condition is true, i is a valid mountain peak.Expand toward the leftStarting from the peak, move left while:arr[left] > arr[left - 1]This finds how far the increasing portion extends.Expand toward the rightStarting from the peak, move right while:arr[right] > arr[right + 1]This finds how far the decreasing portion extends.The peak is counted from both sides, so:mountain length = leftLength + rightLength - 1Java SolutionThe following implementation follows the peak-expansion approach while keeping the extra space at O(1).class Solution { // Finds how far the mountain extends toward the left public int lef(int st, int[] arr) { int len = 1; // Keep moving left while the sequence is strictly increasing // toward the peak. while (st > 0 && arr[st] > arr[st - 1]) { len++; st--; } return len; } // Finds how far the mountain extends toward the right public int righ(int st, int[] arr) { int len = 1; // Keep moving right while the sequence is strictly decreasing // after the peak. while (st < arr.length - 1 && arr[st] > arr[st + 1]) { len++; st++; } return len; } public int longestMountain(int[] arr) { // A mountain must contain at least 3 elements. if (arr.length < 3) { return 0; } int ans = 0; // The first and last elements cannot be peaks, // so start from index 1 and stop at n - 2. for (int i = 1; i < arr.length - 1; i++) { // Check whether arr[i] is a valid peak. if (arr[i - 1] < arr[i] && arr[i] > arr[i + 1]) { // Count the increasing part including the peak. int left = lef(i, arr); // Count the decreasing part including the peak. int right = righ(i, arr); // The peak is counted twice, so subtract 1. int mountainLength = left + right - 1; ans = Math.max(ans, mountainLength); } } return ans; }}Dry RunConsider:arr = [2, 1, 4, 7, 3, 2, 5]Start scanning from index 1.Index 12 1 4 ↑1 is not a peak because:2 < 1 ❌Move forward.Index 22 1 4 7 3 2 5 ↑For 4:1 < 4 > 7Not a peak.Index 32 1 4 7 3 2 5 ↑For 7:4 < 7 > 3So 7 is a valid peak.Expand leftStarting at 7:1 < 4 < 7The left side is:[1, 4, 7]Length:3Expand rightStarting at 7:7 > 3 > 2The right side is:[7, 3, 2]Length:3The peak 7 was counted twice:3 + 3 - 1 = 5Therefore:Longest mountain = 5Why the Peak Is Counted TwiceThis is an important detail in the implementation.Suppose the mountain is:1 4 7 3 2 ↑ peakThe left traversal counts:1 4 7The right traversal counts:7 3 2Adding them gives:3 + 3 = 6But the 7 belongs to both sections.Therefore:6 - 1 = 5Hence:left + right - 1Complexity AnalysisTime ComplexityThe overall complexity is:O(n)Although the implementation expands left and right whenever a peak is found, each increasing/decreasing section belongs to a particular mountain structure and the total traversal remains linear.Space ComplexityOnly a few integer variables are used:O(1)No auxiliary array, HashMap, HashSet, or other data structure is required.One-Pass OptimizationThe same problem can also be solved using a direct one-pass approach.Instead of explicitly expanding from every peak, maintain:the length of the current increasing sectionthe length of the current decreasing sectionWhen an increasing sequence changes into a decreasing sequence, a mountain has been formed.A compact implementation is:class Solution { public int longestMountain(int[] arr) { int n = arr.length; int ans = 0; int up = 0; int down = 0; for (int i = 1; i < n; i++) { // If the sequence starts increasing after a decrease, // begin tracking a new mountain. if (arr[i] > arr[i - 1]) { if (down > 0) { up = 0; down = 0; } up++; } // Continue the decreasing part of the mountain. else if (arr[i] < arr[i - 1] && up > 0) { down++; // A valid mountain requires both an increasing // and decreasing portion. ans = Math.max(ans, up + down + 1); } // Equal adjacent elements break a mountain completely. else { up = 0; down = 0; } } return ans; }}This approach directly satisfies the follow-up requirement:Time = O(n)Space = O(1)Common MistakesTreating a simple increasing sequence as a mountain1 2 3 4 5This is not a mountain because there is no decreasing portion.Treating a simple decreasing sequence as a mountain5 4 3 2 1This is also not a mountain because there is no increasing portion.Allowing equal elements1 3 3 2This is not a valid mountain because the increase must be strict.The conditions require:<>not:<=>=Forgetting the minimum lengthA mountain must contain at least three elements:increasing part + peak + decreasing partTherefore:[1, 2] → invalid[2, 1] → invalid[1, 2, 1] → validInterview TipThe key to this problem is not the code itself but recognizing the peak structure.Whenever a problem describes something like:increasing → peak → decreasinga useful first thought is:Can the middle element be treated as a peak and the structure be expanded from there?This transforms a complicated subarray condition into two simple directional scans.For interview optimization questions, it is also useful to recognize that the same structure can often be tracked using a few variables instead of repeatedly constructing subarrays.ConclusionThe Longest Mountain in Array problem demonstrates an important array technique: identifying a structural peak and analyzing the elements around it.The main ideas are:A mountain must have a valid peak.The left side must be strictly increasing.The right side must be strictly decreasing.Expanding from each peak provides an intuitive solution.The problem can also be optimized into a true one-pass O(n), O(1) solution.The most important pattern to remember is:Increasing → Peak → DecreasingOnce that pattern becomes familiar, similar problems involving peaks, valleys, increasing/decreasing runs, and subarray structures become significantly easier to recognize.

LeetCodeJavaArraysTwo PointersMedium
Intersection of Two Arrays II

Intersection of Two Arrays II

LeetCode Problem 350Link of the Problem to try -: LinkGiven two integer arrays nums1 and nums2, return an array of their intersection. Each element in the result must appear as many times as it shows in both arrays and you may return the result in any order. Example 1:Input: nums1 = [1,2,2,1], nums2 = [2,2]Output: [2,2]Example 2:Input: nums1 = [4,9,5], nums2 = [9,4,9,8,4]Output: [4,9]Explanation: [9,4] is also accepted. Constraints:1 <= nums1.length, nums2.length <= 10000 <= nums1[i], nums2[i] <= 1000Solution:In this question we can build a frequency HashMap of each element and then add into the array as per it's frequency is that is a very important thing in this question to do.For creating frequency we will use getOrDefault() method in HashMap that is very useful for creating frequency as this method returns the value of that key if that key is not exist then whatever value we give that value is considered as default value for us.So, back to question here we simply create a map creating frequency of each element and if the element came again we simply increase the frequency of it then we create a ArrayList because we don't know about the size of array here so we use ArrayList after this we will iterate again on the second array and try to find that element in the map also we check it's frequency should be more than 0 and we add in the List also we decreasing the frequency of the element in the loop.At last we simply take all the elements of ArrayList and put into a array of size of that ArrayList because our questions want's ans in array that's why we have to do this step otherwise our ans is in the ArrayList and this is how we find duplicates of the number of times that element appears in both array.Code: public int[] intersect(int[] nums1, int[] nums2) { HashMap<Integer, Integer> mp = new HashMap<>(); for (int i = 0; i < nums1.length; i++) { // If you are not interested in writing getOrDefault then you can write via if statement as well // int cou =1; // if(mp.containsKey(nums1[i])){ // // int nu = mp.get(nums1[i]); // mp.put(nums1[i],mp.get(nums1[i])+1); // continue; // } // mp.put(nums1[i],cou); // Another way mp.put(nums1[i], mp.getOrDefault(nums1[i], 0) + 1); } List<Integer> lis = new ArrayList<>(); for (int i = 0; i < nums2.length; i++) { if (mp.containsKey(nums2[i]) && mp.get(nums2[i]) > 0) { lis.add(nums2[i]); } mp.put(nums2[i], mp.getOrDefault(nums2[i], 0) - 1); } int[] ans = new int[lis.size()]; for (int i = 0; i < ans.length; i++) { ans[i] = lis.get(i); } return ans; }

LeetcodeEasyHashMapHashSet
Find Length of Loop in Linked List — Complete Guide with Intuition, Dry Run & Floyd’s Cycle Algorithm

Find Length of Loop in Linked List — Complete Guide with Intuition, Dry Run & Floyd’s Cycle Algorithm

🔗 Try This ProblemPractice here:GeeksforGeeks link📌 Problem OverviewYou are given the head of a singly linked list.Your task is:Detect whether a loop (cycle) existsIf a loop exists → return the length of the loopIf no loop exists → return 0🧠 Understanding the ProblemA loop in a linked list means:👉 A node’s next pointer is pointing to a previous node, forming a cycle.Example1 → 2 → 3 → 4 → 5↑ ↓← ← ← ←Here:Loop starts at node 3Loop nodes = 3 → 4 → 5Loop length = 3💡 Intuition — How to Think About This ProblemThere are two main challenges:🔹 1. Detect if a loop exists🔹 2. Find the length of that loop🤔 Brute Force ThinkingStore visited nodes in a HashSetIf node repeats → loop detected✔ Works❌ Extra space O(n)🚀 Optimized Thinking (Floyd’s Cycle Detection)We use:Slow pointer → moves 1 stepFast pointer → moves 2 steps🧠 Key Idea👉 If a loop exists:Fast pointer will eventually meet slow pointer👉 If no loop:Fast pointer reaches null🎥 Visual Intuition & Dry Run⚙️ Optimized Approach (Step-by-Step)Step 1: Detect LoopInitialize:slow = headfast = headMove:slow → 1 stepfast → 2 stepsIf:slow == fast → loop existsStep 2: Find Length of LoopOnce loop is detected:Keep one pointer fixedMove another pointer until it comes backCount stepsWhy This Works?Because:Inside a loop, traversal becomes circularSo eventually, we will return to the same node🧪 Dry Run (Manual Understanding)Example:Loop: 3 → 4 → 5 → 3Step 1: Detect LoopSlow and fast meet inside loopStep 2: Count Loop LengthStart from meeting point:Move one pointer:3 → 4 → 5 → 3Count = 3💻 Code (Java)class Solution {public int lengthOfLoop(Node head) {Node slow = head;Node fast = head;// Step 1: Detect loopwhile(fast != null && fast.next != null){slow = slow.next;fast = fast.next.next;if(fast == slow){// Step 2: Count loop lengthint length = 1;Node temp = slow.next;while(temp != slow){temp = temp.next;length++;}return length;}}return 0; // No loop}}⏱️ Complexity AnalysisTypeValueTime ComplexityO(n)Space ComplexityO(1)🔍 Deep Insight — Why Fast Meets Slow?Fast moves twice as fast as slowInside a loop → paths become circularDifference in speed guarantees collision👉 This is a mathematical certainty in cyclic structures⚠️ Edge CasesNo loop → return 0Single node loop → return 1Large loop → still works efficiently🧩 Key TakeawaysFloyd’s Cycle Detection is powerfulLoop detection + loop length can be done in one traversalNo extra space needed🏁 Final ThoughtsThis problem is a classic linked list concept and very important for interviews.👉 Once you master this:Detect cycleFind loop lengthFind loop starting nodeAll become easier.

GeeksforGeeksLinkedListMediumFast and Slow Pointer
LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

LeetCode 1980: Find Unique Binary String – Multiple Ways to Generate a Missing Binary Combination

Try the ProblemYou can solve the problem here:https://leetcode.com/problems/find-unique-binary-string/Problem DescriptionYou are given an array nums containing n unique binary strings, where each string has length n.Your task is to return any binary string of length n that does not appear in the array.Important ConditionsEach string consists only of '0' and '1'.Every string in the array is unique.The output must be a binary string of length n.If multiple valid answers exist, any one of them is acceptable.ExamplesExample 1Inputnums = ["01","10"]Output"11"ExplanationPossible binary strings of length 2:00011011Since "01" and "10" are already present, valid answers could be:00 or 11Example 2Inputnums = ["00","01"]Output"11"Another valid output could be:10Example 3Inputnums = ["111","011","001"]Output101Other valid answers include:000010100110Constraintsn == nums.length1 <= n <= 16nums[i].length == nnums[i] consists only of '0' and '1'All strings in nums are uniqueImportant ObservationThe total number of binary strings of length n is:2^nBut the array contains only:n stringsSince 2^n grows very quickly and n ≤ 16, there are many possible binary strings missing from the array. Our goal is simply to construct one of those missing strings.Thinking About the ProblemBefore jumping into coding, it's useful to think about different strategies that could help us generate a binary string that does not appear in the array.Possible Ways to Think About the ProblemWhen approaching this problem, several ideas may come to mind:Generate all possible binary strings of length n and check which one is missing.Store all strings in a HashSet or HashMap and construct a candidate string to verify whether it exists.Manipulate existing strings by flipping bits to create new combinations.Use a mathematical trick that guarantees the new string is different from every string in the list.Each of these approaches leads to a different solution strategy.In this article, we will walk through these approaches and understand how they work.Approach 1: Brute Force – Generate All Binary StringsIdeaThe simplest idea is to generate every possible binary string of length n and check whether it exists in the given array.Since there are:2^n possible binary stringsWe can generate them one by one and return the first string that does not appear in nums.StepsConvert numbers from 0 to (2^n - 1) into binary strings.Pad the binary string with leading zeros so its length becomes n.Check if that string exists in the array.If not, return it.Time ComplexityO(2^n * n)This works because n is at most 16, but it is still not the most elegant approach.Approach 2: HashMap + Bit Flipping (My Approach)IdeaWhile solving this problem, another idea is to store all given binary strings inside a HashMap for quick lookup.Then we can try to construct a new binary string by flipping bits from the existing strings.The intuition is simple:If the current character is '0', change it to '1'.If the current character is '1', change it to '0'.By flipping bits at different positions, we attempt to build a new binary combination.Once the string is constructed, we check whether it already exists in the map.If the generated string does not exist, we return it as our answer.Java Implementation (My Solution)class Solution { public String findDifferentBinaryString(String[] nums) { int len = nums[0].length(); // HashMap to store all given binary strings HashMap<String, Integer> mp = new HashMap<>(); for(int i = 0; i < nums.length; i++){ mp.put(nums[i], i); } int cou = 0; String ans = ""; for(int i = 0; i < nums.length; i++){ if(cou < len){ // Flip the current bit if(nums[i].charAt(cou) == '0'){ ans += '1'; cou++; } else{ ans += '0'; cou++; } }else{ // If generated string does not exist in map if(!mp.containsKey(ans)){ return ans; } // Reset and try building again ans = ""; cou = 0; } } return ans; }}Time ComplexityO(n²)Because we iterate through the array and perform string operations.Space ComplexityO(n)For storing the strings in the HashMap.Approach 3: Cantor’s Diagonalization (Optimal Solution)IdeaA clever mathematical observation allows us to construct a string that must differ from every string in the array.We build a new string such that:The first character differs from the first string.The second character differs from the second string.The third character differs from the third string.And so on.By ensuring that the generated string differs from each string at least at one position, it is guaranteed not to exist in the array.This technique is known as Cantor’s Diagonalization.Java Implementationclass Solution { public String findDifferentBinaryString(String[] nums) { int n = nums.length; StringBuilder result = new StringBuilder(); for(int i = 0; i < n; i++){ // Flip the diagonal bit if(nums[i].charAt(i) == '0'){ result.append('1'); } else{ result.append('0'); } } return result.toString(); }}Time ComplexityO(n)We only traverse the array once.Space ComplexityO(n)For storing the resulting string.Comparison of ApproachesApproachTime ComplexitySpace ComplexityNotesBrute ForceO(2^n * n)O(n)Simple but inefficientHashMap + Bit FlippingO(n²)O(n)Constructive approachCantor DiagonalizationO(n)O(n)Optimal and elegantKey TakeawaysThis problem highlights an interesting concept in algorithm design:Sometimes the best solution is not searching for the answer but constructing one directly.By understanding the structure of the input, we can generate a result that is guaranteed to be unique.ConclusionThe Find Unique Binary String problem can be solved using multiple strategies, ranging from brute force enumeration to clever mathematical construction.While brute force works due to the small constraint (n ≤ 16), more elegant solutions exist. Using hashing or constructive approaches improves efficiency and demonstrates deeper algorithmic thinking.Among all approaches, the Cantor Diagonalization technique provides the most efficient and mathematically guaranteed solution.Understanding problems like this helps strengthen skills in string manipulation, hashing, and constructive algorithms, which are commonly tested in coding interviews.

Binary StringsHashingCantor DiagonalizationLeetCodeMedium
Ai Assistant Kas